Peanut Marker Database

AHGS1791 Information

Marker name AHGS1791
Marker category Genome-SSR
Primer sequences Fw CAAACAGCTCGTCAATCGAA
Rv CAAATTGGGTCCAAGCCTAA
EST/Genome sequences SACT06G09
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 5.882
BF6 Linkage BB07
Position 35.617
Integrated consensus map Linkage B07
Position 89.05
Integrated consensus map Linkage B03
Position 32.769
SNP Position
Method
SSR Fragment size 216
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea