Peanut Marker Database

AHGS1790 Information

Marker name AHGS1790
Marker category Genome-SSR
Primer sequences Fw GGACGATAGCAACATCAGCA
Rv GGGCTAAATTCAAACGCAAA
EST/Genome sequences SACT05J06
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 63.492
AF5 Linkage AA03
Position 25.413
BF6 Linkage BB09
Position 4.932
BF6 Linkage BB01
Position 2.61
TF6 Linkage TB09
Position 19.118
Integrated consensus map Linkage A03
Position 85.219
Integrated consensus map Linkage B01
Position 44.222
Integrated consensus map Linkage B09
Position 61.905
SNP Position
Method
SSR Fragment size 217
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea