Peanut Marker Database

AHGS1789 Information

Marker name AHGS1789
Marker category Genome-SSR
Primer sequences Fw TGTTCTCCATGGATCGTTGA
Rv TTGAGATGCCACATGACAAGA
EST/Genome sequences SACT04H06
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 125.647
BF6 Linkage BB09
Position 15.39
TF6 Linkage TB09
Position 20.425
TF6 Linkage TB09
Position 20.702
Integrated consensus map Linkage B09
Position 69.354
Integrated consensus map Linkage B09
Position 69.633
Integrated consensus map Linkage B09
Position 71.697
Integrated consensus map Linkage B04
Position 0.0
SNP Position
Method
SSR Fragment size 287
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea