Peanut Marker Database

AHGS1778 Information

Marker name AHGS1778
Marker category Genome-SSR
Primer sequences Fw CGGCTGCGGTATTCTGATAG
Rv GGATTTTGGTTATGAAATGCTTG
EST/Genome sequences SAAC06H20
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 40.582
BF6 Linkage BB07
Position 36.067
BF6 Linkage BB10
Position 20.85
BF6 Linkage BB04
Position 26.423
Integrated consensus map Linkage A04
Position 50.278
Integrated consensus map Linkage B04
Position 67.118
Integrated consensus map Linkage B07
Position 89.802
Integrated consensus map Linkage B10
Position 61.614
SNP Position
Method
SSR Fragment size 236
Pattern* AC
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea