Peanut Marker Database

AHGS1771 Information

Marker name AHGS1771
Marker category Genome-SSR
Primer sequences Fw TGACCTTCTCCTCTCCTCCA
Rv TCTAAACCATCAAAAATCCGTTC
EST/Genome sequences KICT14G06
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.2
Position 31.666
BF6 Linkage BB04
Position 11.904
BF6 Linkage BB01
Position 10.121
Integrated consensus map Linkage A03
Position 101.86
Integrated consensus map Linkage B01
Position 41.19
Integrated consensus map Linkage B04
Position 55.071
SNP Position
Method
SSR Fragment size 135
Pattern* AC
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea