Peanut Marker Database

AHGS1763 Information

Marker name AHGS1763
Marker category Genome-SSR
Primer sequences Fw CTAACCCAAGCCCATGAAGA
Rv AACATGCATGCAAATGGAAA
EST/Genome sequences KICT10H10
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 15.021
BF6 Linkage BB10
Position 22.699
Integrated consensus map Linkage B10
Position 66.337
Integrated consensus map Linkage B09
Position 70.003
SNP Position
Method
SSR Fragment size 271
Pattern* AG
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea