Peanut Marker Database

AHGS1754 Information

Marker name AHGS1754
Marker category Genome-SSR
Primer sequences Fw AAGTTGTTTGGAAAACCCCC
Rv CGATTTGTTCTTGCATGTGG
EST/Genome sequences KICT08C10
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 59.469
BF6 Linkage BB09
Position 13.56
BF6 Linkage BB04
Position 52.764
TF6 Linkage TB09
Position 19.281
Integrated consensus map Linkage B04
Position 97.137
Integrated consensus map Linkage B09
Position 68.336
SNP Position
Method
SSR Fragment size 198
Pattern* AG
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea