Peanut Marker Database

AHGS1741 Information

Marker name AHGS1741
Marker category Genome-SSR
Primer sequences Fw TTCTTGAAAATTTCCTTGTTGTTTC
Rv TAAGTGTGGGGGAGGATCTG
EST/Genome sequences KIAC14G19
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 20.86
BF6 Linkage BB07
Position 35.975
Integrated consensus map Linkage B07
Position 90.394
Integrated consensus map Linkage A01
Position 78.332
SNP Position
Method
SSR Fragment size 295
Pattern* AC
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea