Peanut Marker Database

AHGS1727 Information

Marker name AHGS1727
Marker category Genome-SSR
Primer sequences Fw ACCATCATCATGGCTGGTTG
Rv TTCAGCTCAACAGTCGCATT
EST/Genome sequences SACT13E24
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.1
Position 199.808
AF5 Linkage AA03
Position 3.899
BF6 Linkage BB10
Position 0.0
TF6 Linkage TA06
Position 8.432
TF6 Linkage TA08
Position 96.469
TF6 Linkage TB02
Position 0.0
Integrated consensus map Linkage B02
Position 40.82
Integrated consensus map Linkage B10
Position 39.203
Integrated consensus map Linkage A03
Position 66.563
Integrated consensus map Linkage A06
Position 8.477
Integrated consensus map Linkage A08
Position 113.727
SNP Position
Method
SSR Fragment size 286
Pattern* AG
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea