Peanut Marker Database

AHGS1718 Information

Marker name AHGS1718
Marker category Genome-SSR
Primer sequences Fw CTGCGCCAACTAAAACATCA
Rv CTCATGACCCTGACCCTGAC
EST/Genome sequences SACT10C09
Lines
PIC Value
Lines
Map NYF2 Linkage LG08.1
Position 65.019
BF6 Linkage BB07
Position 53.259
TF6 Linkage TA08
Position 30.006
TF6 Linkage TB07
Position 38.139
TF6 Linkage TA08
Position 28.481
Integrated consensus map Linkage A08
Position 38.187
Integrated consensus map Linkage A08
Position 39.587
Integrated consensus map Linkage A08
Position 41.579
Integrated consensus map Linkage B07
Position 101.941
SNP Position
Method
SSR Fragment size 197
Pattern* AG
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea