Peanut Marker Database

AHGS1716 Information

Marker name AHGS1716
Marker category Genome-SSR
Primer sequences Fw GCTGGGTTTGCTGGACTAAT
Rv TGTGATTCGTGAGCCCAATA
EST/Genome sequences SACT11I23
Lines
PIC Value
Lines
Map BF6 Linkage BB07
Position 34.468
TF6 Linkage TA08
Position 6.396
Integrated consensus map Linkage B07
Position 90.707
Integrated consensus map Linkage A08
Position 11.458
SNP Position
Method
SSR Fragment size 182
Pattern* AG
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea