Peanut Marker Database

AHGS1694 Information

Marker name AHGS1694
Marker category Genome-SSR
Primer sequences Fw GGCTTGGAACCATTTGAAGA
Rv GAAATGGCTACCTTGGACGA
EST/Genome sequences SACT05I12
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 20.877
TF6 Linkage TA03
Position 33.852
TF6 Linkage TB09
Position 19.159
TF6 Linkage TA01
Position 44.115
Integrated consensus map Linkage A01
Position 78.452
Integrated consensus map Linkage A03
Position 72.917
Integrated consensus map Linkage B09
Position 70.823
SNP Position
Method
SSR Fragment size 279
Pattern* AG
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea