Peanut Marker Database

AHGS1692 Information

Marker name AHGS1692
Marker category Genome-SSR
Primer sequences Fw CCAAAACAAAGCAAAGGGAA
Rv ATCCCAACGAGACCACTCAG
EST/Genome sequences SACT04G02
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.1
Position 78.399
NYF2 Linkage LG07.1
Position 93.093
AF5 Linkage AA07
Position 15.705
BF6 Linkage BB02
Position 3.905
BF6 Linkage BB07
Position 33.8
TF6 Linkage TA07
Position 38.232
TF6 Linkage TB07
Position 25.503
Integrated consensus map Linkage B07
Position 90.912
Integrated consensus map Linkage A07
Position 69.482
Integrated consensus map Linkage B02
Position 52.065
SNP Position
Method
SSR Fragment size 269
Pattern* AG
Repeat count 20
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea