Peanut Marker Database

AHGS1683 Information

Marker name AHGS1683
Marker category Genome-SSR
Primer sequences Fw AGTTGGCAACAACTTGGGAG
Rv GCACGGATTCAGTGTTTCAA
EST/Genome sequences KICT14M08
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.2
Position 71.741
BF6 Linkage BB05
Position 16.92
BF6 Linkage BB09
Position 16.792
TF6 Linkage TA09
Position 35.555
TF6 Linkage TB09
Position 16.332
Integrated consensus map Linkage B09
Position 71.439
Integrated consensus map Linkage A09
Position 88.759
Integrated consensus map Linkage B05
Position 49.425
SNP Position
Method
SSR Fragment size 167
Pattern* AG
Repeat count 21
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea