Peanut Marker Database

AHGS1681 Information

Marker name AHGS1681
Marker category Genome-SSR
Primer sequences Fw AACATGCATGCAAATGGAAA
Rv CCAACTCAAGCCCAAGTAGC
EST/Genome sequences KICT13E19
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 83.248
TF6 Linkage TB05
Position 44.415
TF6 Linkage TA08
Position 110.438
Integrated consensus map Linkage A08
Position 126.324
Integrated consensus map Linkage B05
Position 83.805
SNP Position
Method
SSR Fragment size 267
Pattern* AG
Repeat count 21
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea