Peanut Marker Database

AHGS1677 Information

Marker name AHGS1677
Marker category Genome-SSR
Primer sequences Fw TGGAGAGGGTGAGAGAGGTG
Rv CCTAACGTTCAGGGAGGATG
EST/Genome sequences KICT11K13
Lines
PIC Value
Lines
Map TF6 Linkage TA02
Position 8.077
TF6 Linkage TB09
Position 6.595
Integrated consensus map Linkage B09
Position 58.979
Integrated consensus map Linkage A02
Position 7.966
SNP Position
Method
SSR Fragment size 298
Pattern* AG
Repeat count 21
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea