Peanut Marker Database

AHGS1673 Information

Marker name AHGS1673
Marker category Genome-SSR
Primer sequences Fw AACGGAGGGTCCTACTGCTT
Rv GCGGAGCCTTAAACTTCAAA
EST/Genome sequences KICT10A08
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 82.022
BF6 Linkage BB09
Position 21.463
BF6 Linkage BB04
Position 27.424
TF6 Linkage TA09
Position 35.492
TF6 Linkage TB09
Position 16.846
Integrated consensus map Linkage A09
Position 80.661
Integrated consensus map Linkage B04
Position 65.962
Integrated consensus map Linkage B09
Position 77.461
SNP Position
Method
SSR Fragment size 253
Pattern* AG
Repeat count 21
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea