Peanut Marker Database

AHGS1672 Information

Marker name AHGS1672
Marker category Genome-SSR
Primer sequences Fw CGCCCCTTCTTTTCCTAAAT
Rv GGCAGAGAAGAGGAAGCAGA
EST/Genome sequences KICT09N13
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 56.709
AF5 Linkage AA09
Position 13.836
TF6 Linkage TB05
Position 36.241
TF6 Linkage TA03
Position 63.283
Integrated consensus map Linkage A03
Position 102.247
Integrated consensus map Linkage A09
Position 80.115
Integrated consensus map Linkage B05
Position 65.015
SNP Position
Method
SSR Fragment size 211
Pattern* AG
Repeat count 21
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea