Peanut Marker Database

AHGS1657 Information

Marker name AHGS1657
Marker category Genome-SSR
Primer sequences Fw GCCTTTACGAATACGAACCG
Rv CCGCGACTAATCCACAGAGT
EST/Genome sequences KIAC12K02
Lines
PIC Value
Lines
Map NYF2 Linkage LG07.1
Position 99.078
TF6 Linkage TA07
Position 39.247
TF6 Linkage TA07
Position 38.079
Integrated consensus map Linkage A07
Position 75.848
Integrated consensus map Linkage A07
Position 76.164
Integrated consensus map Linkage A07
Position 76.321
SNP Position
Method
SSR Fragment size 257
Pattern* AC
Repeat count 21
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea