Peanut Marker Database

AHGS1650 Information

Marker name AHGS1650
Marker category Genome-SSR
Primer sequences Fw TGCTAGCTGTTTTGCACTCA
Rv CATTCGAGAGGCTACTACTCTCC
EST/Genome sequences KIAC04B08
Lines
PIC Value
Lines
Map SKF2 Linkage LG01.2
Position 33.22
NYF2 Linkage LG01.2
Position 7.952
AF5 Linkage AA01
Position 30.762
TF6 Linkage TB01
Position 35.612
Integrated consensus map Linkage B01
Position 40.645
Integrated consensus map Linkage A01
Position 88.059
SNP Position
Method
SSR Fragment size 198
Pattern* AG
Repeat count 21
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea