Peanut Marker Database

AHGS1637 Information

Marker name AHGS1637
Marker category Genome-SSR
Primer sequences Fw TGTTAGGGTTTAGCTAAGGGCA
Rv CCTGCCTCCTTTCTGCAATA
EST/Genome sequences SACT12H01
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 9.644
TF6 Linkage TA03
Position 26.527
Integrated consensus map Linkage B03
Position 45.698
Integrated consensus map Linkage A03
Position 65.734
SNP Position
Method
SSR Fragment size 194
Pattern* AAT
Repeat count 14
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea