Peanut Marker Database

AHGS1610 Information

Marker name AHGS1610
Marker category Genome-SSR
Primer sequences Fw TGTGTTTTGGGATATTTGGGA
Rv ACCGTAAAAAGAAAAGCGCA
EST/Genome sequences SAAC14B18
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 36.362
AF5 Linkage AA03
Position 20.359
Integrated consensus map Linkage B05
Position 44.084
Integrated consensus map Linkage A03
Position 81.119
SNP Position
Method
SSR Fragment size 233
Pattern* AC
Repeat count 21
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea