Peanut Marker Database

AHGS1594 Information

Marker name AHGS1594
Marker category Genome-SSR
Primer sequences Fw CCGGCAGAACACTCTCTCTC
Rv GCGAGATAACTGCATCAGCA
EST/Genome sequences KICT13B16
Lines
PIC Value
Lines
Map AF5 Linkage AA10
Position 46.298
BF6 Linkage BB10
Position 32.255
TF6 Linkage TB10
Position 35.328
TF6 Linkage TA10
Position 29.294
Integrated consensus map Linkage A10
Position 110.612
Integrated consensus map Linkage B10
Position 73.528
SNP Position
Method
SSR Fragment size 275
Pattern* AG
Repeat count 22
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea