Peanut Marker Database

AHGS1588 Information

Marker name AHGS1588
Marker category Genome-SSR
Primer sequences Fw TTTGAACTTTGCCACCCTTC
Rv TGGAAGATTGAGGATTGGTTG
EST/Genome sequences KICT08G12
Lines
PIC Value
Lines
Map NYF2 Linkage LG06.2
Position 79.268
TF6 Linkage TB04
Position 20.095
TF6 Linkage TA04
Position 65.367
Integrated consensus map Linkage A04
Position 58.599
Integrated consensus map Linkage B04
Position 76.551
Integrated consensus map Linkage B06
Position 78.129
SNP Position
Method
SSR Fragment size 160
Pattern* AC
Repeat count 22
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea