| Marker name | AHGS1564 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | CTCTCTGCCATTGCATGTGT | |
| Rv | AACTGCTTTTAAAATCTCCCCC | ||
| EST/Genome sequences | SACT10E17 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | SKF2 | Linkage | LG02.2 |
| Position | 28.738 | ||
| BF6 | Linkage | BB10 | |
| Position | 20.642 | ||
| TF6 | Linkage | TB10 | |
| Position | 20.666 | ||
| Integrated consensus map | Linkage | B10 | |
| Position | 59.238 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 275 | |
| Pattern* | AG | ||
| Repeat count | 22 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.