Peanut Marker Database

AHGS1559 Information

Marker name AHGS1559
Marker category Genome-SSR
Primer sequences Fw GAGAGAGCGAGGGAGTGAGA
Rv CCCCTACCCTTCTTCTTCCA
EST/Genome sequences SACT09I03
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 69.926
BF6 Linkage BB02
Position 14.242
Integrated consensus map Linkage B03
Position 71.747
Integrated consensus map Linkage B02
Position 63.994
SNP Position
Method
SSR Fragment size 112
Pattern* AG
Repeat count 22
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea