Peanut Marker Database

AHGS1554 Information

Marker name AHGS1554
Marker category Genome-SSR
Primer sequences Fw CACCTCCCTCTCTATCACTCAC
Rv AATGGTGGCTTGCTATACCG
EST/Genome sequences SACT08M01
Lines
PIC Value
Lines
Map AF5 Linkage AA06
Position 32.91
AF5 Linkage AA10
Position 27.335
BF6 Linkage BB09
Position 14.619
TF6 Linkage TB10
Position 24.801
TF6 Linkage TB09
Position 10.681
Integrated consensus map Linkage A06
Position 60.274
Integrated consensus map Linkage A10
Position 86.266
Integrated consensus map Linkage B09
Position 71.834
Integrated consensus map Linkage B10
Position 55.001
SNP Position
Method
SSR Fragment size 148
Pattern* AG
Repeat count 22
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea