Peanut Marker Database

AHGS1552 Information

Marker name AHGS1552
Marker category Genome-SSR
Primer sequences Fw CGGTGACTCATTCCACACAC
Rv TGCTTCTTTCTCGTCGTCAA
EST/Genome sequences SACT06I01
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 36.908
NYF2 Linkage LG04.1
Position 16.183
BF6 Linkage BB04
Position 24.86
BF6 Linkage BB04
Position 29.803
BF6 Linkage BB03
Position 2.288
TF6 Linkage TA07
Position 38.307
TF6 Linkage TB08
Position 25.664
Integrated consensus map Linkage B04
Position 66.385
Integrated consensus map Linkage B04
Position 72.06
Integrated consensus map Linkage B04
Position 81.348
Integrated consensus map Linkage B08
Position 66.943
Integrated consensus map Linkage A07
Position 75.306
Integrated consensus map Linkage B03
Position 37.313
SNP Position
Method
SSR Fragment size 282
Pattern* AG
Repeat count 22
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea