Peanut Marker Database

AHGS1543 Information

Marker name AHGS1543
Marker category Genome-SSR
Primer sequences Fw ACGTCAGGTTCACAACGACA
Rv ATTTTTCTCCGAGTCAGCCA
EST/Genome sequences SAAC08L07
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.2
Position 50.824
TF6 Linkage TA09
Position 12.967
TF6 Linkage TA09
Position 36.928
Integrated consensus map Linkage A09
Position 102.049
Integrated consensus map Linkage A09
Position 81.597
Integrated consensus map Linkage A09
Position 93.318
SNP Position
Method
SSR Fragment size 196
Pattern* AG
Repeat count 22
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea