Peanut Marker Database

AHGS1531 Information

Marker name AHGS1531
Marker category Genome-SSR
Primer sequences Fw CAGATGTGTGTGTGTGTGTGTG
Rv TGTGGTTCATGCCATTGTTT
EST/Genome sequences KICT11P08
Lines
PIC Value
Lines
Map AF5 Linkage AA06
Position 30.201
BF6 Linkage BB02
Position 13.559
Integrated consensus map Linkage B02
Position 64.357
Integrated consensus map Linkage A06
Position 56.842
SNP Position
Method
SSR Fragment size 244
Pattern* AG
Repeat count 23
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea