Peanut Marker Database

AHGS1500 Information

Marker name AHGS1500
Marker category Genome-SSR
Primer sequences Fw CAATCAAATCAATAATGTCTCTTTCTC
Rv CGCTCGACCAAGAAAAGTTC
EST/Genome sequences SACT07O13
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 26.678
NYF2 Linkage LG09.1
Position 27.742
TF6 Linkage TA09
Position 48.254
TF6 Linkage TB09
Position 31.134
Integrated consensus map Linkage B09
Position 84.572
Integrated consensus map Linkage A09
Position 65.809
SNP Position
Method
SSR Fragment size 238
Pattern* AG
Repeat count 23
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea