Peanut Marker Database

AHGS1478 Information

Marker name AHGS1478
Marker category Genome-SSR
Primer sequences Fw GAATTTGCCGATAAACCCAG
Rv GGGGGTAGAGAGAGAATGGG
EST/Genome sequences KICT11N21
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.2
Position 35.312
AF5 Linkage AA06
Position 38.546
BF6 Linkage BB05
Position 16.759
BF6 Linkage BB09
Position 10.537
BF6 Linkage BB01
Position 0.0
TF6 Linkage TA06
Position 69.345
TF6 Linkage TA09
Position 35.326
Integrated consensus map Linkage B01
Position 30.923
Integrated consensus map Linkage B05
Position 49.789
Integrated consensus map Linkage B09
Position 74.688
Integrated consensus map Linkage A06
Position 68.408
Integrated consensus map Linkage A09
Position 83.976
SNP Position
Method
SSR Fragment size 232
Pattern* AG
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea