Peanut Marker Database

AHGS1470 Information

Marker name AHGS1470
Marker category Genome-SSR
Primer sequences Fw GACACCGCTGGACAAGAAAG
Rv ATCAAAGCAACAACGGGAAC
EST/Genome sequences KICT06N21
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.1
Position 148.217
SKF2 Linkage LG08.2
Position 39.922
NYF2 Linkage LG08.1
Position 29.967
AF5 Linkage AA08
Position 65.384
TF6 Linkage TA08
Position 58.289
TF6 Linkage TB08
Position 16.894
Integrated consensus map Linkage B08
Position 45.502
Integrated consensus map Linkage A08
Position 77.926
SNP Position
Method
SSR Fragment size 156
Pattern* AG
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea