Marker name | AHGS1467 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | AAGAGAAACCCTAGCCGCTT | |
Rv | TGGCAGGGAAGACATGATAA | ||
EST/Genome sequences | KICT07F07 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | AF5 | Linkage | AA06 |
Position | 32.046 | ||
BF6 | Linkage | BB08 | |
Position | 26.696 | ||
BF6 | Linkage | BB09 | |
Position | 17.178 | ||
BF6 | Linkage | BB10 | |
Position | 20.249 | ||
Integrated consensus map | Linkage | B09 | |
Position | 70.448 | ||
Integrated consensus map | Linkage | B10 | |
Position | 61.263 | ||
Integrated consensus map | Linkage | A06 | |
Position | 59.705 | ||
Integrated consensus map | Linkage | B08 | |
Position | 81.789 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 157 | |
Pattern* | AG | ||
Repeat count | 24 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.