Peanut Marker Database

AHGS1467 Information

Marker name AHGS1467
Marker category Genome-SSR
Primer sequences Fw AAGAGAAACCCTAGCCGCTT
Rv TGGCAGGGAAGACATGATAA
EST/Genome sequences KICT07F07
Lines
PIC Value
Lines
Map AF5 Linkage AA06
Position 32.046
BF6 Linkage BB10
Position 20.249
BF6 Linkage BB08
Position 26.696
BF6 Linkage BB09
Position 17.178
Integrated consensus map Linkage A06
Position 59.705
Integrated consensus map Linkage B08
Position 81.789
Integrated consensus map Linkage B09
Position 70.448
Integrated consensus map Linkage B10
Position 61.263
SNP Position
Method
SSR Fragment size 157
Pattern* AG
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea