Peanut Marker Database

AHGS1461 Information

Marker name AHGS1461
Marker category Genome-SSR
Primer sequences Fw TTCAAGACCTCTCCGCTCAT
Rv TTCATCGTGCTCCTTCTCCT
EST/Genome sequences KICT05N02
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 20.96
BF6 Linkage BB03
Position 19.789
TF6 Linkage TB03
Position 70.841
TF6 Linkage TA03
Position 54.815
Integrated consensus map Linkage A03
Position 85.389
Integrated consensus map Linkage B03
Position 51.495
SNP Position
Method
SSR Fragment size 144
Pattern* AG
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea