Peanut Marker Database

AHGS1451 Information

Marker name AHGS1451
Marker category Genome-SSR
Primer sequences Fw TGAGGCACAATGAAGACAGG
Rv TACCCCGTCTCTCTCTCTCG
EST/Genome sequences SACT14B10
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 20.827
BF6 Linkage BB08
Position 17.016
Integrated consensus map Linkage B08
Position 60.048
Integrated consensus map Linkage B03
Position 56.805
SNP Position
Method
SSR Fragment size 203
Pattern* AG
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea