Peanut Marker Database

AHGS1446 Information

Marker name AHGS1446
Marker category Genome-SSR
Primer sequences Fw CAGGAGAGAGAGAAAAGAGAGGAA
Rv GGCGGTAAATTCGACGATAA
EST/Genome sequences SACT11F24
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 69.068
NYF2 Linkage LG02.2
Position 0.0
TF6 Linkage TA06
Position 41.784
TF6 Linkage TB10
Position 25.457
TF6 Linkage TA03
Position 51.849
Integrated consensus map Linkage A03
Position 90.134
Integrated consensus map Linkage A06
Position 42.662
Integrated consensus map Linkage B10
Position 43.642
SNP Position
Method
SSR Fragment size 146
Pattern* AG
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea