Peanut Marker Database

AHGS1437 Information

Marker name AHGS1437
Marker category Genome-SSR
Primer sequences Fw ATTGTGGATGCAGCTGTTGA
Rv AGTTCCCAATCCCATGTTTG
EST/Genome sequences SACT09M03
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.1
Position 160.908
NYF2 Linkage LG07.1
Position 64.862
BF6 Linkage BB08
Position 19.623
BF6 Linkage BB07
Position 32.285
TF6 Linkage TA07
Position 38.617
Integrated consensus map Linkage A07
Position 92.999
Integrated consensus map Linkage B07
Position 92.208
Integrated consensus map Linkage B08
Position 66.055
SNP Position
Method
SSR Fragment size 176
Pattern* AG
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea