Peanut Marker Database

AHGS1432 Information

Marker name AHGS1432
Marker category Genome-SSR
Primer sequences Fw TCCCTAACCAAAAGCCAGTG
Rv AGGAAGCAGGAAGACCATTG
EST/Genome sequences SACT05A24
Lines
PIC Value
Lines
Map TF6 Linkage TA04
Position 3.893
TF6 Linkage TB04
Position 28.308
Integrated consensus map Linkage B04
Position 0.373
Integrated consensus map Linkage A04
Position 4.515
SNP Position
Method
SSR Fragment size 147
Pattern* AG
Repeat count 24
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea