Peanut Marker Database

AHGS1360 Information

Marker name AHGS1360
Marker category Genome-SSR
Primer sequences Fw CAAAAACGGCGAAAACAAAT
Rv TCCTGTTGAAACGCATACCA
EST/Genome sequences SACT13J04
Lines
PIC Value
Lines
Map BF6 Linkage BB02
Position 16.055
TF6 Linkage TB02
Position 18.609
TF6 Linkage TA02
Position 51.468
Integrated consensus map Linkage A02
Position 43.611
Integrated consensus map Linkage B02
Position 64.943
SNP Position
Method
SSR Fragment size 189
Pattern* AG
Repeat count 26
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea