Peanut Marker Database

AHGS1359 Information

Marker name AHGS1359
Marker category Genome-SSR
Primer sequences Fw CAGAAATGACATGCCAGTCG
Rv AAGGCCCACTCACTTAACCC
EST/Genome sequences SACT14I22
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.2
Position 55.172
TF6 Linkage TB06
Position 14.363
TF6 Linkage TA06
Position 59.231
Integrated consensus map Linkage A06
Position 59.075
Integrated consensus map Linkage B06
Position 82.683
SNP Position
Method
SSR Fragment size 211
Pattern* AG
Repeat count 26
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea