Peanut Marker Database

AHGS1357 Information

Marker name AHGS1357
Marker category Genome-SSR
Primer sequences Fw ATGGAGAATAACCAATGGCG
Rv ATCAAAGCGGAACACACACA
EST/Genome sequences SACT11D05
Lines
PIC Value
Lines
Map NYF2 Linkage LG08.2
Position 37.504
BF6 Linkage BB08
Position 21.114
TF6 Linkage TB08
Position 26.933
TF6 Linkage TA07
Position 48.303
Integrated consensus map Linkage A07
Position 86.741
Integrated consensus map Linkage B08
Position 64.171
SNP Position
Method
SSR Fragment size 217
Pattern* AG
Repeat count 26
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea