Peanut Marker Database

AHGS1350 Information

Marker name AHGS1350
Marker category Genome-SSR
Primer sequences Fw AATGTTCATAAACCCTAAATTGTCA
Rv CCCTGAGATTGCATGAGTGA
EST/Genome sequences SACT05E03
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.1
Position 112.222
BF6 Linkage BB05
Position 25.023
BF6 Linkage BB08
Position 23.203
TF6 Linkage TA05
Position 23.945
TF6 Linkage TB05
Position 30.852
Integrated consensus map Linkage A05
Position 53.845
Integrated consensus map Linkage B05
Position 57.5
Integrated consensus map Linkage B08
Position 69.842
SNP Position
Method
SSR Fragment size 143
Pattern* AG
Repeat count 26
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea