Peanut Marker Database

AHGS1342 Information

Marker name AHGS1342
Marker category Genome-SSR
Primer sequences Fw CTGCATAGTGGCGGTGATAA
Rv CATCGGATTAATTCAACGGT
EST/Genome sequences KICT12M18
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 40.858
BF6 Linkage BB05
Position 16.501
BF6 Linkage BB04
Position 57.789
Integrated consensus map Linkage B04
Position 100.592
Integrated consensus map Linkage B05
Position 46.639
SNP Position
Method
SSR Fragment size 157
Pattern* AG
Repeat count 27
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea