Peanut Marker Database

AHGS1329 Information

Marker name AHGS1329
Marker category Genome-SSR
Primer sequences Fw CACATTAGTGAGTTTTTCCCCC
Rv AAAGGCTAATTGTTTAATTTTACTGC
EST/Genome sequences KIAC10D06
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.2
Position 63.568
BF6 Linkage BB08
Position 20.47
TF6 Linkage TA07
Position 54.132
TF6 Linkage TB08
Position 31.13
Integrated consensus map Linkage B08
Position 62.585
Integrated consensus map Linkage A07
Position 93.679
SNP Position
Method
SSR Fragment size 236
Pattern* AC
Repeat count 27
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea