Peanut Marker Database

AHGS1311 Information

Marker name AHGS1311
Marker category Genome-SSR
Primer sequences Fw CACTTGAAGCACCAAATTGAGA
Rv TGGGTGCCATTGTTTCATTA
EST/Genome sequences KICT14B18
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 58.128
AF5 Linkage AA04
Position 39.748
TF6 Linkage TA04
Position 56.425
TF6 Linkage TB04
Position 13.337
Integrated consensus map Linkage B04
Position 74.229
Integrated consensus map Linkage A04
Position 49.971
SNP Position
Method
SSR Fragment size 298
Pattern* AG
Repeat count 28
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea