Peanut Marker Database

AHGS1282 Information

Marker name AHGS1282
Marker category Genome-SSR
Primer sequences Fw TCGTTCTGTTCATCCCATCA
Rv AAGGAGGGAGAAGGAAGCTG
EST/Genome sequences KICT09J18
Lines
PIC Value
Lines
Map NYF2 Linkage LG01.1
Position 10.219
TF6 Linkage TB03
Position 72.526
TF6 Linkage TA01
Position 43.529
TF6 Linkage TB01
Position 35.87
Integrated consensus map Linkage A01
Position 75.541
Integrated consensus map Linkage B01
Position 38.637
Integrated consensus map Linkage B03
Position 61.393
SNP Position
Method
SSR Fragment size 264
Pattern* AG
Repeat count 29
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea