Peanut Marker Database

AHGS1273 Information

Marker name AHGS1273
Marker category Genome-SSR
Primer sequences Fw ACTGGAAATACCCCTGACCC
Rv TGCCGATCCATTTTCTTCTC
EST/Genome sequences SACT10D19
Lines
PIC Value
Lines
Map SKF2 Linkage LG01.2
Position 34.038
TF6 Linkage TB01
Position 35.871
TF6 Linkage TA01
Position 44.887
Integrated consensus map Linkage A01
Position 78.185
Integrated consensus map Linkage B01
Position 33.48
SNP Position
Method
SSR Fragment size 245
Pattern* AG
Repeat count 29
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea