Peanut Marker Database

AHGS1266 Information

Marker name AHGS1266
Marker category Genome-SSR
Primer sequences Fw TCGGATATTACGACGACTCTGA
Rv TGAGAACCCTTTTGAGGACG
EST/Genome sequences SACT04E06
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.1
Position 103.289
BF6 Linkage BB10
Position 43.927
Integrated consensus map Linkage B10
Position 85.891
Integrated consensus map Linkage A07
Position 86.453
SNP Position
Method
SSR Fragment size 264
Pattern* AC
Repeat count 29
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea