Peanut Marker Database

AHGS1263 Information

Marker name AHGS1263
Marker category Genome-SSR
Primer sequences Fw TCCATCAAAACCATCCCATT
Rv ATGGAGCTCCCAGATCAACA
EST/Genome sequences KICT11D19
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.1
Position 87.242
NYF2 Linkage LG07.1
Position 97.491
AF5 Linkage AA10
Position 27.622
AF5 Linkage AA07
Position 15.914
TF6 Linkage TA07
Position 38.434
Integrated consensus map Linkage A07
Position 73.878
Integrated consensus map Linkage A10
Position 90.524
SNP Position
Method
SSR Fragment size 217
Pattern* AG
Repeat count 30
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea